, 6 de febrero de 2017
La diputada Eva Felícitas Cadena Sandoval, presidenta de la Comisión Permanente de Medio Ambiente, Recursos Naturales y Cambio Climático de la LXIV Legislatura de Veracruz, anunció la presentación de denuncias ante la Fiscalía General del Estado (FGE) en contra de quien resulte responsable por el delito de maltrato animal, por los hechos suscitados el pasado 1 de febrero en el municipio de Tlacotalpan.
En conferencia de prensa, la legisladora por MORENA recordó que el pasado 1 de febrero en las fiestas de “La Candelaria” en Tlacotalpan un grupo de personas maltrató severamente a algunos toros, por lo que debe aplicárseles la legislación estatal en relación al maltrato animal.
Indicó que la Procuraduría de Medio Ambiente y ella como presidenta de la Comisión de Medio Ambiente han hecho lo conducente ante la FGE. Deben abrirse las carpetas de investigación y dar con las personas que cometieron este ilícito para que afronten las consecuencias legales, refirió.
En cualquier circunstancia, añadió, las ciudadanas y ciudadanos veracruzanos esperan que no haya concesiones para algún grupo; por lo que los diputados pugnan porque se haga valer la ley y se investigue este caso especifico.
Aunque en Tlacotalpan hubo personal de la Fiscalía General, estos fueron insuficientes ante un grupo de personas violentas, dijo la diputada, quien añadió que la FGE hizo su trabajo preventivo, pero que ahora corresponde integrar la investigación y aplicar la ley por el delito de maltrato hacia los animales.
The single stranded cDNA was added to the gene specific
replica oakleys primer mix and SYBR GREEN PCR Master Mix (Applied Biosystems). Gene specific primers were as follows: Gabrb1: 5′ CGGAAAAGGCCCTCAGAAA (sense) and 5′ GCATCAACCTGGACTTTGTTCA (antisense); Gapdh: 5′ GGCCTACATGGCCTCCAA (sense) and 5′ GCCTCTCTCTTGCTCTCAGTATCC (antisense); Knca1: 5′ GCAATCAAAAGCCCCCAAAC (sense) and 5′ CCACCCCCCAAATTCACAA (antisense); Opkr1: 5′ GCACATGTCCTGGCAACAATAC (sense) and 5′ GATGGAGGTGCAGTAAATCGA (antisense); Slc18a3: 5′ CACCAGTCCTTCTTCTTTTGCG (sense) and 5′ GCGGTTCATCAAGCAACACA (antisense); Sst: 5′ AAGCTGGCTGCAAGAACTTCT (sense) and 5′ AGAGGTCTGGCTGAGACAACAA (antisense). Good morning. Good morning, george. Super bowl ticket prices are sky high and tickets are scarce. One man hopes to change that
cheap nfl jerseys in the courtroom. He’s a fan with a plan. To tackle what he calls unfair ticket prices for the biggest game in town. Championship play right here, fellas. We can make an argument for the Winter Olympics in New England (fewer sports than the Summer Games; spread it out toward Maine, New Hampshire, and Vermont), but there’s nothing to be said about the dream of a Summer Games here sometime in the future. Boston simply does not have the infrastructure, the curse that you
Cheap NFL Jerseys live with when you’re one of the birthplaces of this country. It’s too old. Too small. Too ornery. ‘In Limelight, there’s no earnest blue helmeted hero in sight. Instead, you play as the Robot Masters, who have set about beating the bolts out of one another because it gets pretty damn
Cheap Oakleys boring waiting in their little gated boss rooms while Megaman misses the same jump 15 times in a row. And while playing as the villains is already a pretty sweet concept, the developers have taken it one step further.Three hundred
cheap nfl jerseys and fifty two (352) fatalities occurred with the use of open motorboats, just over half of all boating fatalities. One hundred and one (101) people lost their lives while using canoes/kayaks in
cheap nfl jerseys 2001. Approximately ninety three (93) percent of canoe/kayak deaths were caused by drowning. Fifty (50) fatalities occurred with the use of Personal Watercraft (PWC), the lowest number of PWC fatalities reported since 1993. Approximately eighty (80) percent of all reported injuries were associated with the use of open motorboats (46%) and PWC (34%). Lacerations were the most reported type of injury for open motorboats. For PWC, broken bones were the most often reported type of injury.Eagles roll over injury riddled Rams Michael Vick (7) of the Philadelphia Eagles looks to pass against St. Louis Rams at the Edward Jones Dome on September 11, 2011 in St. Louis, Missouri. The Eagles quarterback was in dazzling form and the other Philly game breakers were hard to catch, too, as the
Fake ray bans team opened its self proclaimed Super Bowl drive with a 31 13 victory over the St. Louis Rams.